ID: 1148301198_1148301203

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148301198 1148301203
Species Human (GRCh38) Human (GRCh38)
Location 17:46550286-46550308 17:46550336-46550358
Sequence CCTGGGTGACAGAGTGAGACCCT CAGCTACTCACCTGGAATACTGG
Strand - +
Off-target summary {0: 6598, 1: 26231, 2: 68050, 3: 126125, 4: 184175} {0: 2, 1: 4, 2: 2, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!