|
Left Crispr |
Right Crispr |
| Crispr ID |
1148301200 |
1148301203 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:46550306-46550328
|
17:46550336-46550358
|
| Sequence |
CCTCTTTCAAAAAAATAAAAAAG |
CAGCTACTCACCTGGAATACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 10, 2: 274, 3: 4147, 4: 32857} |
{0: 2, 1: 4, 2: 2, 3: 14, 4: 164} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|