ID: 1148377164_1148377168

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1148377164 1148377168
Species Human (GRCh38) Human (GRCh38)
Location 17:47159153-47159175 17:47159196-47159218
Sequence CCAGGCTTAATTCACTTTATTTT TTGTAGCCACAGCTGGAGCCCGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 10, 3: 143, 4: 1694} {0: 19, 1: 13, 2: 11, 3: 38, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!