|
Left Crispr |
Right Crispr |
Crispr ID |
1148377164 |
1148377168 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:47159153-47159175
|
17:47159196-47159218
|
Sequence |
CCAGGCTTAATTCACTTTATTTT |
TTGTAGCCACAGCTGGAGCCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 1, 2: 10, 3: 143, 4: 1694} |
{0: 19, 1: 13, 2: 11, 3: 38, 4: 274} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|