ID: 1148415187_1148415195

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148415187 1148415195
Species Human (GRCh38) Human (GRCh38)
Location 17:47500848-47500870 17:47500898-47500920
Sequence CCCAATTCCTGGATGTTTAAATA ATTAATTCCTCACTACCAGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 34, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!