ID: 1148621085_1148621094

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1148621085 1148621094
Species Human (GRCh38) Human (GRCh38)
Location 17:49035477-49035499 17:49035507-49035529
Sequence CCCTGGGAGCCTGGGCAGATGCG GGTGCGCTGGGAGGTGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205} {0: 1, 1: 0, 2: 3, 3: 48, 4: 604}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!