ID: 1148754352_1148754361

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1148754352 1148754361
Species Human (GRCh38) Human (GRCh38)
Location 17:49964883-49964905 17:49964911-49964933
Sequence CCATTCTCCGGGCCTCGCTGAAT GGCTCTATCCACAGCGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!