ID: 1148805594_1148805603

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1148805594 1148805603
Species Human (GRCh38) Human (GRCh38)
Location 17:50262305-50262327 17:50262341-50262363
Sequence CCACAAGGTACCGGCCTCCAGGG TCCTGGCCCTCAGGGCCTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 23, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!