ID: 1148812449_1148812453

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1148812449 1148812453
Species Human (GRCh38) Human (GRCh38)
Location 17:50302345-50302367 17:50302385-50302407
Sequence CCAAGTTTGAGGGATTTGAATCA ATAACCTTGGTAGAAGCTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!