|
Left Crispr |
Right Crispr |
| Crispr ID |
1149275342 |
1149275350 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:55027354-55027376
|
17:55027400-55027422
|
| Sequence |
CCTTGAGTATCATAAGGCAAGCA |
TTGGAGACTCAGAAGGGGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 31, 3: 50, 4: 165} |
{0: 21, 1: 69, 2: 201, 3: 326, 4: 745} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|