ID: 1149370088_1149370100

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1149370088 1149370100
Species Human (GRCh38) Human (GRCh38)
Location 17:55985359-55985381 17:55985404-55985426
Sequence CCACTGTGTCCCTCCCATGACAT TTCAAGATGAGATTTGGATGGGG
Strand - +
Off-target summary {0: 8, 1: 294, 2: 950, 3: 2507, 4: 5078} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!