ID: 1149370091_1149370099

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149370091 1149370099
Species Human (GRCh38) Human (GRCh38)
Location 17:55985368-55985390 17:55985403-55985425
Sequence CCCTCCCATGACATGTGGGAATT ATTCAAGATGAGATTTGGATGGG
Strand - +
Off-target summary {0: 182, 1: 866, 2: 3319, 3: 5812, 4: 7115} {0: 521, 1: 8557, 2: 11490, 3: 11630, 4: 9310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!