ID: 1149370093_1149370098

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1149370093 1149370098
Species Human (GRCh38) Human (GRCh38)
Location 17:55985372-55985394 17:55985402-55985424
Sequence CCCATGACATGTGGGAATTATGG AATTCAAGATGAGATTTGGATGG
Strand - +
Off-target summary {0: 133, 1: 887, 2: 2679, 3: 4912, 4: 6273} {0: 546, 1: 8662, 2: 13006, 3: 11577, 4: 9085}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!