ID: 1149595506_1149595530

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1149595506 1149595530
Species Human (GRCh38) Human (GRCh38)
Location 17:57862498-57862520 17:57862550-57862572
Sequence CCCTGCCTCCCCAGAGTCCTCCA GCTGGGTGACCGGGAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 51, 4: 560} {0: 1, 1: 0, 2: 2, 3: 28, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!