ID: 1149595507_1149595530

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1149595507 1149595530
Species Human (GRCh38) Human (GRCh38)
Location 17:57862499-57862521 17:57862550-57862572
Sequence CCTGCCTCCCCAGAGTCCTCCAG GCTGGGTGACCGGGAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 512} {0: 1, 1: 0, 2: 2, 3: 28, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!