ID: 1149658801_1149658806

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1149658801 1149658806
Species Human (GRCh38) Human (GRCh38)
Location 17:58324063-58324085 17:58324080-58324102
Sequence CCGTGCAAACTTTGGGGGAGGAC GAGGACAGGTCTTGATGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130} {0: 1, 1: 0, 2: 0, 3: 22, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!