ID: 1149849975_1149849990

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1149849975 1149849990
Species Human (GRCh38) Human (GRCh38)
Location 17:60028476-60028498 17:60028516-60028538
Sequence CCTCCTGCCCTCCCCCTTCTGTG ATGGGAGGGCAGCCCCACAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 10, 3: 130, 4: 1193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!