ID: 1149871970_1149871974

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149871970 1149871974
Species Human (GRCh38) Human (GRCh38)
Location 17:60191063-60191085 17:60191098-60191120
Sequence CCTAGCTCCTTGTCTGTAAAATG AATGCATATAAAAGTTTACAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 11, 3: 117, 4: 669} {0: 1, 1: 0, 2: 1, 3: 45, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!