ID: 1150216999_1150217008

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1150216999 1150217008
Species Human (GRCh38) Human (GRCh38)
Location 17:63476671-63476693 17:63476685-63476707
Sequence CCTGGGGCCCCGGCCTTGTCACT CTTGTCACTCCGGAGGCGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!