ID: 1150455864_1150455865

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1150455864 1150455865
Species Human (GRCh38) Human (GRCh38)
Location 17:65305982-65306004 17:65305995-65306017
Sequence CCATGGGGAGCGGCTGTAAATAC CTGTAAATACAGATGAAGCTTGG
Strand - +
Off-target summary {0: 6, 1: 50, 2: 43, 3: 60, 4: 85} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!