ID: 1150612832_1150612846

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1150612832 1150612846
Species Human (GRCh38) Human (GRCh38)
Location 17:66747916-66747938 17:66747953-66747975
Sequence CCGGGGGGTGCCGGGCCAGAAAG GAGCTGGGAGGAGGGCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153} {0: 1, 1: 1, 2: 4, 3: 66, 4: 633}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!