ID: 1150823732_1150823739

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1150823732 1150823739
Species Human (GRCh38) Human (GRCh38)
Location 17:68457113-68457135 17:68457130-68457152
Sequence CCAACCTTGTCGCTCTGGGAGGA GGAGGACACTGGGAGTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106} {0: 1, 1: 0, 2: 9, 3: 93, 4: 797}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!