ID: 1150823732_1150823743

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1150823732 1150823743
Species Human (GRCh38) Human (GRCh38)
Location 17:68457113-68457135 17:68457136-68457158
Sequence CCAACCTTGTCGCTCTGGGAGGA CACTGGGAGTGGGGTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106} {0: 1, 1: 2, 2: 30, 3: 219, 4: 1399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!