ID: 1151249321_1151249329

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1151249321 1151249329
Species Human (GRCh38) Human (GRCh38)
Location 17:72821380-72821402 17:72821417-72821439
Sequence CCTGTAGTCCCAGCTACTCAGGA AACCGATTGAACTCAGGAGGCGG
Strand - +
Off-target summary {0: 40895, 1: 157395, 2: 217955, 3: 208005, 4: 130380} {0: 1, 1: 17, 2: 1385, 3: 22225, 4: 68735}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!