ID: 1151360407_1151360413

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1151360407 1151360413
Species Human (GRCh38) Human (GRCh38)
Location 17:73585257-73585279 17:73585276-73585298
Sequence CCCTATGCCATGCGCTTCTCGTA CGTAGTGGGTGGCAGAGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 28} {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!