ID: 1151668294_1151668299

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1151668294 1151668299
Species Human (GRCh38) Human (GRCh38)
Location 17:75558004-75558026 17:75558017-75558039
Sequence CCCTAGGCTCCATGCATGGGTCC GCATGGGTCCTGCTGCCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!