ID: 1151816414_1151816427

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1151816414 1151816427
Species Human (GRCh38) Human (GRCh38)
Location 17:76473584-76473606 17:76473611-76473633
Sequence CCCACAGGAAGCCGCAGCTCGGG CAGTGGGATGGCTGAGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92} {0: 1, 1: 0, 2: 2, 3: 45, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!