ID: 1151816422_1151816428

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1151816422 1151816428
Species Human (GRCh38) Human (GRCh38)
Location 17:76473595-76473617 17:76473617-76473639
Sequence CCGCAGCTCGGGGGGGCAGTGGG GATGGCTGAGGCCAGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 252} {0: 1, 1: 0, 2: 7, 3: 82, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!