|
Left Crispr |
Right Crispr |
| Crispr ID |
1151853533 |
1151853535 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:76706181-76706203
|
17:76706199-76706221
|
| Sequence |
CCACGCTGCCATCACAGAGGCCC |
GGCCCACGCTGCCATCACAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 9, 2: 10, 3: 22, 4: 248} |
{0: 4, 1: 2, 2: 13, 3: 13, 4: 111} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|