ID: 1152049221_1152049233

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1152049221 1152049233
Species Human (GRCh38) Human (GRCh38)
Location 17:77959204-77959226 17:77959233-77959255
Sequence CCGCCGCCAGGCCCGCGCCACCG CGCGGAGCCGCCGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 714} {0: 1, 1: 3, 2: 16, 3: 125, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!