ID: 1152049228_1152049234

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152049228 1152049234
Species Human (GRCh38) Human (GRCh38)
Location 17:77959221-77959243 17:77959234-77959256
Sequence CCACCGGAGCCCCGCGGAGCCGC GCGGAGCCGCCGCCGCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 255} {0: 1, 1: 3, 2: 24, 3: 194, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!