ID: 1152104012_1152104018

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1152104012 1152104018
Species Human (GRCh38) Human (GRCh38)
Location 17:78318512-78318534 17:78318530-78318552
Sequence CCACTCCAACTGGTCCCAGATGC GATGCATCAGAGGGTGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 166} {0: 1, 1: 0, 2: 1, 3: 19, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!