ID: 1152104012_1152104021

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1152104012 1152104021
Species Human (GRCh38) Human (GRCh38)
Location 17:78318512-78318534 17:78318546-78318568
Sequence CCACTCCAACTGGTCCCAGATGC ACCCTGGGAGGCCAGTCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!