ID: 1152321021_1152321039

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152321021 1152321039
Species Human (GRCh38) Human (GRCh38)
Location 17:79608944-79608966 17:79608995-79609017
Sequence CCACGCCCCCACCCCGCCGGCGC GCCCATACCCGGCTTTCATCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 28, 3: 217, 4: 1484} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!