ID: 1152321532_1152321539

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1152321532 1152321539
Species Human (GRCh38) Human (GRCh38)
Location 17:79610788-79610810 17:79610827-79610849
Sequence CCGCAGAGCGAGGCGGGCGACGA GGCTCAGCGCTCCCCGCGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 11, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!