ID: 1152321574_1152321583

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1152321574 1152321583
Species Human (GRCh38) Human (GRCh38)
Location 17:79610928-79610950 17:79610959-79610981
Sequence CCGGCGAGCCAGCGGCAAGGGGC CCGGGCTCGGGCGGCAGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 133} {0: 1, 1: 0, 2: 4, 3: 44, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!