ID: 1152530419_1152530421

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152530419 1152530421
Species Human (GRCh38) Human (GRCh38)
Location 17:80915290-80915312 17:80915317-80915339
Sequence CCTCTCTGCTGAGAGCTGAGCAG CAGGAAAACCAGCTGCAGAGAGG
Strand - +
Off-target summary {0: 32, 1: 61, 2: 232, 3: 472, 4: 857} {0: 1, 1: 30, 2: 113, 3: 221, 4: 718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!