ID: 1152552003_1152552018

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1152552003 1152552018
Species Human (GRCh38) Human (GRCh38)
Location 17:81034787-81034809 17:81034817-81034839
Sequence CCTCCCCGCCCCCAGCCCGGCTG GGCCCCCTCAGGCTGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 29, 3: 206, 4: 1547} {0: 1, 1: 0, 2: 2, 3: 37, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!