ID: 1152594459_1152594474

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152594459 1152594474
Species Human (GRCh38) Human (GRCh38)
Location 17:81231684-81231706 17:81231735-81231757
Sequence CCTCGACCCTGCCAGGGGGAATG CCCCCACTCCTGTCTCGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202} {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!