ID: 1152604747_1152604754

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152604747 1152604754
Species Human (GRCh38) Human (GRCh38)
Location 17:81283483-81283505 17:81283496-81283518
Sequence CCAGCATCAGCCCGATCATGCTG GATCATGCTGCACAGGGACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111} {0: 1, 1: 0, 2: 1, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!