ID: 1152751623_1152751630

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1152751623 1152751630
Species Human (GRCh38) Human (GRCh38)
Location 17:82065146-82065168 17:82065167-82065189
Sequence CCCTTCTAAGGCCGCTCCAGTAC ACCACCGTTGGGTCACACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 41} {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!