ID: 1152802013_1152802031

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152802013 1152802031
Species Human (GRCh38) Human (GRCh38)
Location 17:82334904-82334926 17:82334944-82334966
Sequence CCCCAGCCCCCGCCCTCGGGGAA TGCCAGTGAGATGCTGGAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!