ID: 1152802016_1152802034

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1152802016 1152802034
Species Human (GRCh38) Human (GRCh38)
Location 17:82334910-82334932 17:82334946-82334968
Sequence CCCCCGCCCTCGGGGAAACCCCA CCAGTGAGATGCTGGAGAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!