ID: 1152872775_1152872781

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1152872775 1152872781
Species Human (GRCh38) Human (GRCh38)
Location 17:82766855-82766877 17:82766885-82766907
Sequence CCACAGGGCCTGTGTCATTCCCC GAGATGTGACCACACCTGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 38, 4: 366} {0: 2, 1: 0, 2: 0, 3: 17, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!