ID: 1153131276_1153131280

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1153131276 1153131280
Species Human (GRCh38) Human (GRCh38)
Location 18:1857727-1857749 18:1857763-1857785
Sequence CCAAAAGGAGAATGGTTATCTGT GCCTTGCTCCAAAATCCTAGAGG
Strand - +
Off-target summary No data {0: 143, 1: 187, 2: 148, 3: 132, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!