|
Left Crispr |
Right Crispr |
| Crispr ID |
1153206859 |
1153206863 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
18:2712521-2712543
|
18:2712544-2712566
|
| Sequence |
CCACATAAACAGAGGCCAACTTT |
TCATATACACAGGTTCTGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 5, 1: 4, 2: 15, 3: 70, 4: 238} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|