ID: 1153596374_1153596383

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1153596374 1153596383
Species Human (GRCh38) Human (GRCh38)
Location 18:6729614-6729636 18:6729644-6729666
Sequence CCAGCCCGTGGGCGTGGTTCCCA CGAATTCGCGCGCCCGGGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!