ID: 1153837247_1153837250

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1153837247 1153837250
Species Human (GRCh38) Human (GRCh38)
Location 18:8974958-8974980 18:8974975-8974997
Sequence CCGTAAAAAAGAGATCCTGTCAT TGTCATTTGCAAAACATGGATGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 44, 3: 144, 4: 381} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!