ID: 1154423917_1154423924

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1154423917 1154423924
Species Human (GRCh38) Human (GRCh38)
Location 18:14257741-14257763 18:14257770-14257792
Sequence CCCTGCAGCTCCAGCACCAGCCG AAAGATGCACAGGTACAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 12, 3: 86, 4: 597} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!