ID: 1154428890_1154428893

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1154428890 1154428893
Species Human (GRCh38) Human (GRCh38)
Location 18:14293366-14293388 18:14293379-14293401
Sequence CCAGCCATGACTGAAAGATGCAC AAAGATGCACAGGTACAGCTTGG
Strand - +
Off-target summary {0: 9, 1: 43, 2: 41, 3: 44, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!