ID: 1155542591_1155542601

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1155542591 1155542601
Species Human (GRCh38) Human (GRCh38)
Location 18:26884050-26884072 18:26884085-26884107
Sequence CCCCATATGGCGGGGGGTGTCCA GTGGATCATAATACCCAGTGGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 18, 3: 101, 4: 564} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!